Journal Article

Poly(ADP-ribose) polymerase at active centromeres and neocentromeres at metaphase

Elizabeth Earle, Alka Saxena, Andrew MacDonald, Damien F. Hudson, Lisa G. Shaffer, Richard Saffery, Michael R. Cancilla, Suzanne M. Cutts, Emily Howman and K. H. Andy Choo

in Human Molecular Genetics

Volume 9, issue 2, pages 187-194
Published in print January 2000 | ISSN: 0964-6906
Published online January 2000 | e-ISSN: 1460-2083 | DOI: http://dx.doi.org/10.1093/hmg/9.2.187
Poly(ADP-ribose) polymerase at active centromeres and neocentromeres at metaphase

Show Summary Details

Preview

A double-stranded 9 bp GTGAAAAAG pJα sequence found in human centromeric α-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo‐ centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable PARP purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis of human and sheep metaphase cells using a polyclonal anti-PARP antibody revealed centromeric localization of PARP, with diffuse signals also seen on the chromosome arms. Similar results were observed for mouse chromosomes except for a significantly enlarged PARP-binding region around the core centromere-active domain, suggesting possible ‘spreading’ of PARP into surrounding non-core centromeric domains. Enhanced PARP signals were also observed on α-satellite-negative human neo‐ centromeres and on the active but not the inactive α-satellite-containing centromere of a human dicentric chromosome. PARP signals were absent from the q12 heterochromatin of the Y chromosome, suggesting a correlation of PARP binding with centromere function that is independent of heterochromatic properties. Preliminary cell cycle analysis indicates detectable centromeric association of PARP during S/G2 phase and that the total proportion of PARP that is centromeric is relatively low. Strong binding of PARP to different centromere sequence motifs may offer a versatile mechanism of mammalian centromere recognition that is independent of primary DNA sequences.

Journal Article.  6494 words.  Illustrated.

Subjects: Genetics and Genomics

Full text: subscription required

How to subscribe Recommend to my Librarian

Users without a subscription are not able to see the full content. Please, subscribe or login to access all content.